Bienvenidos al foro
autovazclub club chile internacional
para todos los fanaticos y aficionados de vehiculos lada habla hispana ven y participa
***este foro es de todos .
***el contenido de este foro es libre de ser copiado por todas las nacionalidades de usuarios solo se pide hacer referencia al foro.
***este es un foro libre y democratico la unica regla es presentarte a la comunidad.
***en este foro esta prohibido el baneo por expresar tu opinion.
***ademas eres libre de participar en todos los foros existentes o crear tu propio club de la marca
en tu pais o ciudad .
***por un conocimiento libre de ataduras

julio 2009-2099
Mejores posteadores
filipus (8589)
vostock1 (2350)
julio veloz (1368)
707 (1329)
Elurbanuss (957)
Mvaz (920)
link (873)
Jeancillo (707)
2103ericko (652)
acg (626)

Los posteadores más activos de la semana

sube tus imagenes aqui
Últimos temas
» hola a todos ... tengo un lada 2105
Hoy a las 6:43 am por patomauser

» Bomba de gasolina
Ayer a las 8:20 am por criss

Ayer a las 8:15 am por criss

» luces de tablero 2105
Ayer a las 8:14 am por criss

» Manual taller Lada Samara
Ayer a las 7:32 am por alexbernabe

Lun Sep 11, 2017 6:00 am por sebas7ian93

» calibracion de valvulas ¿cuando hacerlo?
Lun Sep 11, 2017 5:50 am por sebas7ian93

Lun Sep 11, 2017 5:30 am por sebas7ian93

» q es esto ?...
Vie Sep 08, 2017 7:11 am por criss

» discos de frenos pegados lada samara 2109 97`
Vie Sep 08, 2017 12:45 am por titolada.93

» transformar un carburador catalitico a convencional?
Jue Sep 07, 2017 5:28 pm por criss

» manual 2104-2105 en español
Miér Sep 06, 2017 11:02 pm por Jose Alfonso Pardo

» Carburador 2105 station
Lun Sep 04, 2017 5:56 am por Pabloaliaga

» samara 2108 problemas electricos
Dom Ago 27, 2017 12:47 am por Tavata

» saludos a todos / como contactar con el admin?
Dom Ago 27, 2017 12:42 am por Tavata

Dom Ago 27, 2017 12:34 am por Tavata

» Problema Electrico
Dom Ago 27, 2017 12:31 am por Tavata

» manuales lada en general
Dom Ago 27, 2017 12:29 am por Tavata

» Tablero de instrumentos
Dom Ago 27, 2017 12:16 am por Tavata

» lada 2107 con inyección
Sáb Ago 26, 2017 6:47 pm por 707

» el carburador de los lada en general
Vie Ago 25, 2017 7:33 pm por Tavata

» hola me presento
Vie Ago 25, 2017 6:38 pm por Tavata

» ¿alguien sabe algo sobre el captador y modulo del samara?
Vie Ago 25, 2017 6:07 pm por Tavata

» sistema de encendido electronico del lada 2104
Vie Ago 25, 2017 2:03 am por Tavata

» AYUDA! carburador del lada 2108 1300 se para el motor
Jue Ago 24, 2017 9:27 pm por Tavata

Jue Ago 24, 2017 9:18 pm por Tavata

» medida de los chicleres?? para lada samara
Jue Ago 24, 2017 1:06 am por Tavata

» manual lada 2105
Mar Ago 22, 2017 1:14 pm por CAPL12345

Sáb Ago 19, 2017 12:05 am por ysaborit

» mi samara 2108 le cuesta mucho encender después de unos dias apagado
Miér Ago 16, 2017 4:39 am por richi

» Sellos de agua y sistema de agüita del sapito
Miér Ago 16, 2017 4:24 am por richi

» Por fin tengo un Vaz !!
Vie Ago 11, 2017 11:21 pm por elcomandok9

» Presentacion y agradecimiento
Mar Ago 08, 2017 9:31 am por tatodiaz19

» Me presento y a mi bb
Lun Jul 31, 2017 4:23 am por Tonysamara

» carburador samara 1500 catalitico
Lun Jul 31, 2017 3:59 am por Tonysamara

» Buenas as tardes
Lun Jul 31, 2017 3:41 am por Tonysamara

Miér Jul 26, 2017 4:51 am por jokin214

» piezas de 2104 (station Wagon en desarme)
Lun Jul 24, 2017 6:54 am por pablo7127

» Aviso de falla.
Miér Jul 19, 2017 6:39 pm por Camilo Torres Guillermo

» presentación y gracias por resivirme
Sáb Jul 15, 2017 8:16 am por dario21

Jue Jul 13, 2017 7:36 pm por Mario Hurtado v8

» problemas comunes en las radio de autos y alguna solucion
Jue Jul 13, 2017 6:27 am por Masterkau

» Me Presento (Felipe Gomez = Masterkau)
Jue Jul 13, 2017 6:15 am por Masterkau

» Ayuda para identificar esta parte del carburador
Mar Jul 11, 2017 9:27 pm por yosvenky

» MANUAL DE REPARACIONES 2101 2102 2104 2105 2106 2108 2109 2110 21213
Mar Jul 11, 2017 10:06 am por José Eloy Moreno González

» Manual de taller Samara 2110 (21099i) en Ruso (fotos)
Mar Jul 11, 2017 6:24 am por tato1250

» Se vende lada niva
Lun Jul 10, 2017 1:08 am por Invitado

» Me presento como TITO
Dom Jul 09, 2017 10:14 am por titolada.93

» Juego Android Google play
Dom Jul 09, 2017 5:51 am por ets

» no seas irresponsable aprende a usar los liquidos refrigerantes
Jue Jul 06, 2017 4:56 am por mariodj

» manual lada 1117 1118 1119 despiece en español lada kalina
Miér Jul 05, 2017 4:51 am por Lechu

» cremallera de direccion
Miér Jul 05, 2017 4:12 am por mariodj

» Problema con radiador
Vie Jun 23, 2017 10:36 pm por cristobal guzman

» Presentación gracias por la bienvenida
Vie Jun 23, 2017 8:37 am por Josemarz

» maletero del lada 2106
Vie Jun 23, 2017 8:29 am por Josemarz

» como cambiar luces del tablero y sacar el tablero..modelos linea samara 2108 al 2109
Mar Jun 20, 2017 5:39 am por mauriziobmx

» vaz 2106 problemas relanti
Dom Jun 18, 2017 9:12 am por Dimitri2106

» Motor + Caja de cambios lada Niva, 2104, 2105, 2106 y 2107
Dom Jun 18, 2017 9:07 am por Dimitri2106

» mi primer 2109 1.3
Jue Jun 15, 2017 5:39 pm por filipus

Jue Jun 15, 2017 5:31 pm por filipus


Resultados por:

Rechercher Búsqueda avanzada


Lun Sep 11, 2017 6:00 am por sebas7ian93

hola chicos saludos desde Colombia tengo un lasa 2106 que ando reparandole el motor la caja y la transmisión pero tengo una duda con la cuestión de la calibración de las válvulas pues hay unas …

[ Lectura completa ]

Comentarios: 0

Carburador 2105 station

Lun Sep 04, 2017 5:56 am por Pabloaliaga

Estimados todos,
Junto con saludar me presento, mi nombre es Pablo Aliaga y quisiera por favor , q alguno de ustedes puede facilitarme lo antes nombrado.

Comentarios: 0

saludos a todos / como contactar con el admin?

Miér Dic 07, 2016 4:40 pm por Anonymous


saludos a todos los miembros!

estoy confundido, acabo de inscribirme y no puedo enviar mensajes privados y necesito contactar con el administrador, pero no se en que forma puedo hacerlo. les …

[ Lectura completa ]

Comentarios: 6

hola me presento

Vie Ago 25, 2017 9:55 am por miloroa

hola me presento soy miloroa de la septima region amante de los veiculos carburados solamente y me pareciò interezante el foro

Comentarios: 1

Septiembre 2017

Calendario Calendario

Locations of visitors to this page
VAZ en el foro
foros amigos

problemas con mi lada

Ver el tema anterior Ver el tema siguiente Ir abajo

problemas con mi lada

Mensaje por cccristixn el Dom Mar 08, 2015 11:31 pm

hola amigos laderos tengo un problema con mi lada samara resulta que por las mañanas al encenderlo le suenan las valvulas pero es solo cuando esta frio por que cuando agarra temperatura anda bien no le suena nada es solo cuando esta frio y suena mucho no se que puede ser ayuda !!!!


Mensajes : 10
Puntos : 2055
Fecha de inscripción : 24/02/2012

Volver arriba Ir abajo

Re: problemas con mi lada

Mensaje por desde_cuba el Lun Mar 09, 2015 6:10 pm

Hola amigo, no tengo experiencia en el samara pero la esencia de los motores es la misma, asi que eso me suema a
-el tiempo del motor, eso se ajusta
-calibracion de las valvulas
-tensar cadena

estas cosas las debes hacer cada cierto tiempo
esto es lo mas simple de hacer si esto no te funciona entonces hay que pensar en otras cosas



Mensajes : 95
Puntos : 1150
Fecha de inscripción : 22/11/2014

Volver arriba Ir abajo

Re: problemas con mi lada

Mensaje por cccristixn el Mar Mar 10, 2015 6:52 am

gracias por responder yo igual creo que calibracion de valvulas lo malo es que traen chauchas y es muy dificil calibrarlas


Mensajes : 10
Puntos : 2055
Fecha de inscripción : 24/02/2012

Volver arriba Ir abajo

Re: problemas con mi lada

Mensaje por desde_cuba el Miér Mar 11, 2015 2:16 am

cccristixn escribió:gracias por responder yo igual creo que calibracion de valvulas lo malo es que traen chauchas y es muy dificil calibrarlas

Hola, no hay de que, para eso estamos

calibrar un motor es cosa seria, debe ser por alguien que sepa pq te queda apretado algo y fundes el motor

ahh otra cosa que puede hacer que las valvulas suenen es gasolina de muy bajo octanaje



Mensajes : 95
Puntos : 1150
Fecha de inscripción : 22/11/2014

Volver arriba Ir abajo

Re: problemas con mi lada

Mensaje por alvaro.acostar el Mar Nov 24, 2015 7:06 pm

hola soy alvaro y tengo un lada samara del 92 y ahora tiene problemas resulta que antes no, y ahora tengo problema con la partida no parte me da contacto prende las luces pero no parte me suena como tacatacatacatacatacatacatacataca y viene en motor de partida nose si se habran pegados los carbones, los fusblis ya estan malos o reley me dijeron que el alternador esta bueno pero igual dudo por fa ayuda


Mensajes : 1
Puntos : 667
Fecha de inscripción : 24/11/2015

Volver arriba Ir abajo

Re: problemas con mi lada

Mensaje por Contenido patrocinado

Contenido patrocinado

Volver arriba Ir abajo

Ver el tema anterior Ver el tema siguiente Volver arriba

- Temas similares

Permisos de este foro:
No puedes responder a temas en este foro.